nls cfp control addgene Search Results


nls cfp control  (Addgene inc)
93
Addgene inc nls cfp control
Nls Cfp Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nls+cfp+control+addgene/pAd-PV-NLS-CD-DsRed+(Plasmid+%2316345)/pm30416059-257-9-12
Average 93 stars, based on 1 article reviews
nls cfp control - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
pdesttol2-quas:nls-gfp-he1  (Addgene inc)
92
Addgene inc pdesttol2-quas:nls-gfp-he1
Pdesttol2 Quas:Nls Gfp He1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nls+cfp+control+addgene/T4+Lysozyme+L99F+M102L+V111I+WT*+(Plasmid+%2318481)/pmc11142643-55-4-9
Average 92 stars, based on 1 article reviews
pdesttol2-quas:nls-gfp-he1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
31865 ubc nls ha mcp yfp lentiviral addgene 31230 prrl ubcp p53 cfp  (Addgene inc)
92
Addgene inc 31865 ubc nls ha mcp yfp lentiviral addgene 31230 prrl ubcp p53 cfp
(A) Experimental approaches using fixed cells provide access to single snapshots of the relationships between transcription factors, mRNA and proteins. (B-D) Cells received IR. <t>p53</t> and p21 reporter protein levels were imaged in live cells 8h post-IR, fixed immediately afterwards and probed for p21 transcription using FISH. Scatter plots show <t>p53</t> <t>protein</t> levels and p21 transcription (B), p21 transcription and p21 protein levels (C) and p53 and p21 protein levels (D) (n > 200 cells). Dashed box highlights cells with high p53 levels but low p21 transcription. Cells that lacked evidence of p21 protein induction were excluded from the analysis (STAR Methods). (E) Distinct models can explain low correlations between molecular species at fixed timepoints. (F) Schematic of experimental system to track live p21 transcription dynamics. Endogenous tagging of the p21 locus allows quantification of p21 mRNA production and p21 protein. MS2 repeats in p21 3’ UTR fold into hairpins that are recognized by the constitutively expressed MCP-YFP. (G) Comparison of MCP-YFP foci (p21-MS2 signal) and p21 FISH. Bright foci in nuclei correspond to sites of nascent transcription. p21 transcription was induced by treating with the MDM2 inhibitor nutlin-3a and images were obtained after 2.5h. (H) Comparison of signal intensity of p21-MS2 signal in live-cells and p21 FISH in fixed cells 8h after irradiation, when cells exhibit substantial heterogeneity in p53 levels. Cells that lacked evidence of p21 protein induction were excluded from the analysis (STAR Methods). See also Figures S1 and S2.
31865 Ubc Nls Ha Mcp Yfp Lentiviral Addgene 31230 Prrl Ubcp P53 Cfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nls+cfp+control+addgene/UbC+NLS-HA-MCP-YFP+(Plasmid+%2331230)/pmc07413213-509-79-83
Average 92 stars, based on 1 article reviews
31865 ubc nls ha mcp yfp lentiviral addgene 31230 prrl ubcp p53 cfp - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

Image Search Results


(A) Experimental approaches using fixed cells provide access to single snapshots of the relationships between transcription factors, mRNA and proteins. (B-D) Cells received IR. p53 and p21 reporter protein levels were imaged in live cells 8h post-IR, fixed immediately afterwards and probed for p21 transcription using FISH. Scatter plots show p53 protein levels and p21 transcription (B), p21 transcription and p21 protein levels (C) and p53 and p21 protein levels (D) (n > 200 cells). Dashed box highlights cells with high p53 levels but low p21 transcription. Cells that lacked evidence of p21 protein induction were excluded from the analysis (STAR Methods). (E) Distinct models can explain low correlations between molecular species at fixed timepoints. (F) Schematic of experimental system to track live p21 transcription dynamics. Endogenous tagging of the p21 locus allows quantification of p21 mRNA production and p21 protein. MS2 repeats in p21 3’ UTR fold into hairpins that are recognized by the constitutively expressed MCP-YFP. (G) Comparison of MCP-YFP foci (p21-MS2 signal) and p21 FISH. Bright foci in nuclei correspond to sites of nascent transcription. p21 transcription was induced by treating with the MDM2 inhibitor nutlin-3a and images were obtained after 2.5h. (H) Comparison of signal intensity of p21-MS2 signal in live-cells and p21 FISH in fixed cells 8h after irradiation, when cells exhibit substantial heterogeneity in p53 levels. Cells that lacked evidence of p21 protein induction were excluded from the analysis (STAR Methods). See also Figures S1 and S2.

Journal: Cell systems

Article Title: Quantifying the Central Dogma in the p53 pathway in live single cells

doi: 10.1016/j.cels.2020.05.001

Figure Lengend Snippet: (A) Experimental approaches using fixed cells provide access to single snapshots of the relationships between transcription factors, mRNA and proteins. (B-D) Cells received IR. p53 and p21 reporter protein levels were imaged in live cells 8h post-IR, fixed immediately afterwards and probed for p21 transcription using FISH. Scatter plots show p53 protein levels and p21 transcription (B), p21 transcription and p21 protein levels (C) and p53 and p21 protein levels (D) (n > 200 cells). Dashed box highlights cells with high p53 levels but low p21 transcription. Cells that lacked evidence of p21 protein induction were excluded from the analysis (STAR Methods). (E) Distinct models can explain low correlations between molecular species at fixed timepoints. (F) Schematic of experimental system to track live p21 transcription dynamics. Endogenous tagging of the p21 locus allows quantification of p21 mRNA production and p21 protein. MS2 repeats in p21 3’ UTR fold into hairpins that are recognized by the constitutively expressed MCP-YFP. (G) Comparison of MCP-YFP foci (p21-MS2 signal) and p21 FISH. Bright foci in nuclei correspond to sites of nascent transcription. p21 transcription was induced by treating with the MDM2 inhibitor nutlin-3a and images were obtained after 2.5h. (H) Comparison of signal intensity of p21-MS2 signal in live-cells and p21 FISH in fixed cells 8h after irradiation, when cells exhibit substantial heterogeneity in p53 levels. Cells that lacked evidence of p21 protein induction were excluded from the analysis (STAR Methods). See also Figures S1 and S2.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-p21WAF1 EMD Millipore Ab-1; cat#OP64 RRID:AB_213423 Mouse monoclonal anti-p53 Santa Cruz Biotechnology sc-126 (DO1); RRID:AB_628082 Rabbit polyclonal anti-RFP MBL international PM005; RRID:AB_591279 Mouse monoclonal anti-β-Actin Sigma A5316; RRID:AB_476743 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor 926–32210 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Licor 926–32211 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody Licor 926–68070 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor 926–68071 Bacterial and Virus Strains pCR4–24XMS2SL-stable Addgene 31865 UbC NLS-HA-MCP-YFP (lentiviral) Addgene 31230 pRRL-UbCp-p53-CFP (lentiviral) This work N/A pDONR221-p21homology-mCherryp2aNeo-24xMS2-p21homology This work N/A pRRL-CMV-CFP-hGeminin(1–100) (lentiviral) Karanam, et al. 2012 N/A Chemicals, Peptides, and Recombinant Proteins DAPI Sigma D9542 Nutlin3-a Cayman Chemical N/A Neocarzinostatin (NCS) Sigma N9162 Cytochalasin D Sigma C8273 Critical Commercial Assays p21 smFISH probes Biosearch Technologies ( Purvis, et al 2012 ) SMF-1065–5 Custom probes Deposited Data Single cell imaging data This work doi: 10.17632/nwt5m8ktgt.1 Experimental Models: Cell Lines Human: MCF7 Hafner, et al 2017 N/A Human: MCF7 + MCP-YFP + p53-CFP + p21-mCherry-P2A-Neo-24XMS2 (endogenous tag) This work N/A Human: MCF7 + MCP-YFP + p21-mCherry-P2ANeo-24XMS2 + CFP-hGeminin(1–100) This work N/A Oligonucleotides p21 Forward: GACTCTCAGGGTCGAAAACG This work N/A p21 wild type Reverse: AAGATGTAGAGCGGGCCTTT This work N/A p21 mCherry MS2 Reverse: CATGTTATCCTCCTCGCCCT This work N/A GAPDH Forward: ACATCGCTCAGACACCATG This work N/A GAPDH Reverse: TGTAGTTGAGGTCAATGAAGGG This work N/A Recombinant DNA pCas9-T2A-p21gRNA GGCTTCCTGTGGGCGGATTA Stewart-Ornstein and Lahav, 2016 N/A Software and Algorithms Custom analysis scripts This work doi: 10.17632/nwt5m8ktgt.1 P53Cinema Single Cell Tracking Software Reyes et al., 2018 https://github.com/balvahal/p53CinemaManual Open in a separate window KEY RESOURCES TABLE p53 oscillations lead to oscillations in p21 transcription and p21 protein derivative. p53 levels affect the probability, rather than the magnitude, of p21 transcription.

Techniques: Irradiation

(A) A system to quantify the dynamics of p53 protein, p21 transcription and p21 protein in live single cells. (B) Pulsatile dynamics of p53 lead to pulses of p21 transcription and step-wise accumulation of p21 protein. Within each pulse, p21 transcription exhibits bursty dynamics. (C) Heterogeneity in p53 expression allows quantification of input-output relationships across a range of p53 expression levels. Transcription probability scales with p53 levels, whereas transcription magnitude saturates at low p53 levels.

Journal: Cell systems

Article Title: Quantifying the Central Dogma in the p53 pathway in live single cells

doi: 10.1016/j.cels.2020.05.001

Figure Lengend Snippet: (A) A system to quantify the dynamics of p53 protein, p21 transcription and p21 protein in live single cells. (B) Pulsatile dynamics of p53 lead to pulses of p21 transcription and step-wise accumulation of p21 protein. Within each pulse, p21 transcription exhibits bursty dynamics. (C) Heterogeneity in p53 expression allows quantification of input-output relationships across a range of p53 expression levels. Transcription probability scales with p53 levels, whereas transcription magnitude saturates at low p53 levels.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-p21WAF1 EMD Millipore Ab-1; cat#OP64 RRID:AB_213423 Mouse monoclonal anti-p53 Santa Cruz Biotechnology sc-126 (DO1); RRID:AB_628082 Rabbit polyclonal anti-RFP MBL international PM005; RRID:AB_591279 Mouse monoclonal anti-β-Actin Sigma A5316; RRID:AB_476743 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor 926–32210 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Licor 926–32211 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody Licor 926–68070 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor 926–68071 Bacterial and Virus Strains pCR4–24XMS2SL-stable Addgene 31865 UbC NLS-HA-MCP-YFP (lentiviral) Addgene 31230 pRRL-UbCp-p53-CFP (lentiviral) This work N/A pDONR221-p21homology-mCherryp2aNeo-24xMS2-p21homology This work N/A pRRL-CMV-CFP-hGeminin(1–100) (lentiviral) Karanam, et al. 2012 N/A Chemicals, Peptides, and Recombinant Proteins DAPI Sigma D9542 Nutlin3-a Cayman Chemical N/A Neocarzinostatin (NCS) Sigma N9162 Cytochalasin D Sigma C8273 Critical Commercial Assays p21 smFISH probes Biosearch Technologies ( Purvis, et al 2012 ) SMF-1065–5 Custom probes Deposited Data Single cell imaging data This work doi: 10.17632/nwt5m8ktgt.1 Experimental Models: Cell Lines Human: MCF7 Hafner, et al 2017 N/A Human: MCF7 + MCP-YFP + p53-CFP + p21-mCherry-P2A-Neo-24XMS2 (endogenous tag) This work N/A Human: MCF7 + MCP-YFP + p21-mCherry-P2ANeo-24XMS2 + CFP-hGeminin(1–100) This work N/A Oligonucleotides p21 Forward: GACTCTCAGGGTCGAAAACG This work N/A p21 wild type Reverse: AAGATGTAGAGCGGGCCTTT This work N/A p21 mCherry MS2 Reverse: CATGTTATCCTCCTCGCCCT This work N/A GAPDH Forward: ACATCGCTCAGACACCATG This work N/A GAPDH Reverse: TGTAGTTGAGGTCAATGAAGGG This work N/A Recombinant DNA pCas9-T2A-p21gRNA GGCTTCCTGTGGGCGGATTA Stewart-Ornstein and Lahav, 2016 N/A Software and Algorithms Custom analysis scripts This work doi: 10.17632/nwt5m8ktgt.1 P53Cinema Single Cell Tracking Software Reyes et al., 2018 https://github.com/balvahal/p53CinemaManual Open in a separate window KEY RESOURCES TABLE p53 oscillations lead to oscillations in p21 transcription and p21 protein derivative. p53 levels affect the probability, rather than the magnitude, of p21 transcription.

Techniques: Expressing

KEY RESOURCES TABLE

Journal: Cell systems

Article Title: Quantifying the Central Dogma in the p53 pathway in live single cells

doi: 10.1016/j.cels.2020.05.001

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-p21WAF1 EMD Millipore Ab-1; cat#OP64 RRID:AB_213423 Mouse monoclonal anti-p53 Santa Cruz Biotechnology sc-126 (DO1); RRID:AB_628082 Rabbit polyclonal anti-RFP MBL international PM005; RRID:AB_591279 Mouse monoclonal anti-β-Actin Sigma A5316; RRID:AB_476743 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor 926–32210 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Licor 926–32211 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody Licor 926–68070 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor 926–68071 Bacterial and Virus Strains pCR4–24XMS2SL-stable Addgene 31865 UbC NLS-HA-MCP-YFP (lentiviral) Addgene 31230 pRRL-UbCp-p53-CFP (lentiviral) This work N/A pDONR221-p21homology-mCherryp2aNeo-24xMS2-p21homology This work N/A pRRL-CMV-CFP-hGeminin(1–100) (lentiviral) Karanam, et al. 2012 N/A Chemicals, Peptides, and Recombinant Proteins DAPI Sigma D9542 Nutlin3-a Cayman Chemical N/A Neocarzinostatin (NCS) Sigma N9162 Cytochalasin D Sigma C8273 Critical Commercial Assays p21 smFISH probes Biosearch Technologies ( Purvis, et al 2012 ) SMF-1065–5 Custom probes Deposited Data Single cell imaging data This work doi: 10.17632/nwt5m8ktgt.1 Experimental Models: Cell Lines Human: MCF7 Hafner, et al 2017 N/A Human: MCF7 + MCP-YFP + p53-CFP + p21-mCherry-P2A-Neo-24XMS2 (endogenous tag) This work N/A Human: MCF7 + MCP-YFP + p21-mCherry-P2ANeo-24XMS2 + CFP-hGeminin(1–100) This work N/A Oligonucleotides p21 Forward: GACTCTCAGGGTCGAAAACG This work N/A p21 wild type Reverse: AAGATGTAGAGCGGGCCTTT This work N/A p21 mCherry MS2 Reverse: CATGTTATCCTCCTCGCCCT This work N/A GAPDH Forward: ACATCGCTCAGACACCATG This work N/A GAPDH Reverse: TGTAGTTGAGGTCAATGAAGGG This work N/A Recombinant DNA pCas9-T2A-p21gRNA GGCTTCCTGTGGGCGGATTA Stewart-Ornstein and Lahav, 2016 N/A Software and Algorithms Custom analysis scripts This work doi: 10.17632/nwt5m8ktgt.1 P53Cinema Single Cell Tracking Software Reyes et al., 2018 https://github.com/balvahal/p53CinemaManual Open in a separate window KEY RESOURCES TABLE p53 oscillations lead to oscillations in p21 transcription and p21 protein derivative. p53 levels affect the probability, rather than the magnitude, of p21 transcription.

Techniques: Recombinant, Imaging, Software, Single Cell Tracking